A Small-Molecule Antagonist of HIF2a Is Efficacious in Preclinical Models of Renal Cell Carcinoma
Eli M. Wallace, James P. Rizzi, Guangzhou Han, Paul M. Wehn, Zhaodan Cao, Xinlin Du, Tzuling Cheng, Robert M. Czerwinski, Darryl D. Dixon, Barry S. Goggin, Jonas A. Grina, Megan M. Halfmann, Melissa A. Maddie, Sarah R. Olive, Stephen T. Schlachter, Huiling Tan, Bin Wang, Keshi Wang, Shanhai Xie, Rui Xu, Hanbiao Yang, and John A. Josey
Abstract
More than 90% of clear cell renal cell carcinomas (ccRCC) exhibit inactivation of the von Hippel–Lindau (pVHL) tumor suppressor, establishing it as the major underlying cause of this malignancy. pVHL inactivation results in stabilization of the hypoxia-inducible transcription factors, HIF1a and HIF2a, leading to expression of a genetic program essential for the initiation and progression of ccRCC. Herein, we describe the potent, selective, and orally active small-molecule inhibitor PT2385 as a specific antagonist of HIF2a that allosterically blocks its dimerization with the HIF1a/2a transcriptional dimerization partner ARNT/HIF1b. PT2385 inhibited the
expression of HIF2a-dependent genes, including VEGF-A, PAI-1, and cyclin D1 in ccRCC cell lines and tumor xenografts. Treatment of tumor-bearing mice with PT2385 caused dramatic tumor regressions, validating HIF2a as a pivotal oncogenic driver in ccRCC. Notably, unlike other anticancer agents that inhibit VEGF receptor signaling, PT2385 exhibited no adverse effect on cardiovascular performance. Thus, PT2385 represents a novel class of therapeutics for the treatment of RCC with potent preclincal efficacy as well as improved tolerability rel-ative to current agents that target the VEGF pathway. Cancer Res;
76(18); 5491–500. 2016 AACR.
Introduction
Aberrant activation of transcription factors is frequently asso-ciated with pathophysiologic conditions, including cancer. Tran-scription factors typically complex with other proteins and reg-ulate gene transcription by binding to specific DNA sequences. As such, with the exception of nuclear hormone receptors, this class of proteins has been perceived as intractable targets for pharma-cologic intervention. HIF2a is one such protein that has been implicated in the initiation and progression of kidney cancer.
Nearly 64,000 new cases of kidney cancer were diagnosed in the United States in 2014, with approximately 70% being clear cell renal cell carcinoma (ccRCC; ref. 1). Patients with advanced disease are currently treated with antiangiogenesis agents, such as multitargeted tyrosine kinase inhibitors and specific VEGF
Peloton Therapeutics, Inc., Dallas, Texas.
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).
Current address for D.D. Dixon: Bristol-Myers Squibb, New Brunswick, New
Jersey; current address for M.M. Halfmann: Stowers Institute for Medical
Research, Kansas City, Missouri; current address for M.A. Maddie: Renovo Neural, Inc., Cleveland, Ohio; and current address for S.R. Olive: Progen Lab, Dallas, Texas.
Corresponding Author: Eli M. Wallace, Peloton Therapeutics Inc., 2330 Inwood
Road, Suite 226, Dallas, TX 75235. Phone: 972-629-4126; Fax: 972-629-4111;
E-mail: [email protected]
doi: 10.1158/0008-5472.CAN-16-0473
2016 American Association for Cancer Research.
antagonists, inhibitors of mTOR, and immunomodulatory agents, such as inhibitors of PD-1. Few patients experience a complete response to these agents, and nearly all tumors progress during treatment (2). For patients with advanced or metastatic ccRCC, the 5-year survival rate is only 8% (1). It is thus clear that better therapeutic options are needed.
The HIFa family of transcription factors consists of HIF1a, HIF2a, and the less well characterized HIF3a (3–5). Under hypoxic conditions, HIFa proteins accumulate and translocate to the nucleus, where they dimerize with ARNT. The HIFa–ARNT heterodimers bind to the hypoxia-responsive elements (HRE) on target genes whose products coordinately regulate anaerobic metabolism, angiogenesis, cell proliferation and survival, extra-cellular matrix remodeling, pH homeostasis, amino acid and nucleotide metabolism, and genome stability (6–8). Under nor-moxic conditions, specific proline residues on the HIFa proteins are hydroxylated by the dioxygenase HIF-specific prolyl-hydro-xylases (9, 10). These posttranslational modifications serve as recognition sites for the von Hippel–Lindau (pVHL) tumor sup-pressor protein, which binds to the hydroxylated proline residues as part of an E3 ubiquitin–ligase complex that then targets HIFa proteins for proteasomal degradation.
In more than 90% of ccRCC patients, pVHL is defective, caused by gene deletion, mutation, epigenetic silencing, or posttransla-tional modifications (11), resulting in the stabilization of HIFa proteins. Over the last decade, accumulating data have suggested an oncogenic role for HIF2a in pVHL-defective ccRCC. In pVHL-defective ccRCC xenografts, knockdown of HIF2a expression inhibits tumor formation comparable with reintroduction of functional VHL, and overexpression of a stabilized variant of
www.aacrjournals.org 5491
Wallace et al.
HIF2a alone is sufficient to overcome the tumor-suppressive effect of pVHL (12–15). In contrast, HIF1a is often deleted or mutated in ccRCC, and overexpression of HIF1a inhibited tumor growth in pVHL-defective xenografts (12, 16, 17). These data suggest that HIF2a may be the tumorigenic driver in ccRCC and highlight the therapeutic potential of HIF2a antagonists for its treatment.
Biophysical studies have revealed a hydrophobic pocket in the HIF2a PAS-B domain, leading to the discovery of a small mol-ecule that binds within the pocket and allosterically disrupts HIF2a dimerization to ARNT (18–19). Although this early work was seminal in identifying the possibility of antagonizing this transcription factor, the reported antagonists exhibit modest cellular potency and, most importantly, poor physical properties that preclude their use in validating HIF2a as a target for treatment of ccRCC. Guided by iterative structure-based design utilizing the heterodimer of PAS-B domains of HIF2a and ARNT, we have discovered potent HIF2a antagonists with excellent pharmaco-logic properties, thereby enabling in vivo evaluation of this novel anticancer mechanism. Here, we describe PT2385 [(S)-3-((2,2-difluoro-1-hydroxy-7-(methylsulfonyl)-2,3-dihydro-1H-inden-
4-yl)oxy)-5-fluorobenzonitrile] (Fig. 1A), a HIF2a antagonist with potent antitumor activity. We also propose a mechanism by which this molecule inhibits HIF2a transcriptional activity.
Materials and Methods
Crystallography of HIF2a-B :ARNT-B complex
The preparation of HIF2a-B :ARNT-B complex was described previously (20). The crystals of the heterodimer were produced by hanging drop vapor diffusion. The well solution contained 16% PEG 3350 and 50 mmol/L BisTris, pH 5.4, and the crystallization drop was obtained by mixing 1 mL of well solution and 1 mL of heterodimer at 12 mg/mL in 20 mmol/L Tris-HCl, pH 8.0, and 1 mmol/L DTT. Right after the mixing, crystal seeds from crushed old crystals were transferred to the drop with a whisker. Diffrac-tion quality crystals typically grew after 2 or 3 days. For soaking, 5 mL of the soaking solution, which consisted of 1 mmol/L PT2385, 20% PEG 3350, 5% DMSO, and 50 mmol/L Bis-Tris, pH 5.4, was added to a crystal drop. Typically, soaking was carried out for 2 or 3 days before harvest. Freezing solution consisted of 1 mmol/L PT2385, 20% PEG 3350, 15% DMSO, and 50 mmol/L Bis-Tris,
A F B
F
NC O OH
O O
S
F PT2385
C HIF2α HIF1α D DMSO PT2385
0.01 0.1 1 10 μmol/L
ARNT
HIF2α
IP: HIF2α
Kd = 0.049 μmol/L
Figure 1.
Binding of PT2385 to HIF2a PAS-B domain disrupts HIF2a/ARNT dimer formation. A, chemical structure of PT2385. Synthetic procedures, scheme, and characterization of PT2385 are available in Supplementary Methods. B, ribbon diagram of co-crystal structure of HIF2a PAS-B domain (green), ARNT PAS-B domain (blue), and PT2385 (magenta). C, binding affinity of PT2385 to PAS-B domains of human HIF2a and HIF1a using ITC. D, coimmunoprecipitation (IP) experiment in 786-O cells demonstrating PT2385 disrupts HIF2a and ARNT dimerization.
5492 Cancer Res; 76(18) September 15, 2016 Cancer Research
pH 5.4. For harvest, crystals were briefly soaked in the freezing solution for a few seconds before they were flash frozen in liquid nitrogen. Diffraction data were collected at beam-line 19ID at Advanced Photon Source (Argonne National Laboratory). All data were indexed and scaled with program HKL2000 (21). Model building and refinement were carried out with COOT (22) and REFMACS (23), respectively.
Isothermal titration calorimetry
Human HIF2a-B was expressed and purified as described earlier (20). Rat HIF2a differs from human HIF2a-B by only three amino acids. So, the expression vector for human HIF2a-B was mutated at these residues (T262L, I 265V, and I326V) to make rat HIF2a-B. Pas-B domain of HIF1a was unstable, and the complex of HIF1a-B :ARNT-B was used for isothermal titration calorimetry (ITC). The complex was coex-pressed in Escherichia coli harboring pET28-HIF1a-B and pGB1-ARNT-B and copurified in a single step of Ni-affinity chromatography. The binding affinity between PT2385 and PAS-B domains was determined using ITC on an iTC200 system (GE Healthcare). PAS-B at 0.4 mmol/L was titrated into 40 mmol/L of PT2385 in the cell in buffer consisting of 20 mmol/L Tris-HCl, pH 8.0, 150 mmol/L KCl, and 1% DMSO.
Cell culture
786-O, A498, Hep3B, and Caki-1 cell lines were purchased from ATCC. All were acquired in 2012 and were maintained in culture for no more than 30 continuous passages. The cells were cultured in DMEM (D5796, Sigma) supplemented with 10% FBS (F6178, Sigma), 100 units penicillin, and 100 mg/mL streptomy-cin (P4333, Sigma).
For compound treatment, 5 105 cells were plated into 6-well cell culture plates (Corning cat# 3506) in 2 mL of medium. Compound dissolved in DMSO was added as the cultures reached confluence with the final concentration of DMSO at 0.1%. For hypoxia-treated cells, cell cultures were placed in the chamber supplied with 1% oxygen and 5% CO2 (COY Laboratory Pro-ducts) for more then 4 hours before compound addition and maintained under the hypoxic condition for the duration of compound treatment.
All relevant human cell lines used in experiments were obtained from ATCC. ATCC authenticated cell lines with short tandem repeat profiling.
Coimmunoprecipitation of HIFa and ARNT
Cells in 6-well plate were lysed in 1 mL of cell lysis buffer (Tris-HCl 20 mmol/L, pH 7.5, Triton X-100 1%, NaCl 150 mmol/L, glycerol 5%, EDTA 1 mmol/L, DTT 1 mmol/L, and 1 tablet per 10 mL of Roche Protease Inhibitor Tablet Complete). A total of 1 mg of mouse mAb against human ARNT (Santa Cruz Biotechnology, sc-55526) or 1 mg of antibody against HIF2a (Abcam Ab199) and 50 mL of Protein AG Beads (Santa Cruz Biotechnology 50% slurry in lysis buffer) were added to cleared cell lysate. The tubes were rotated at 4 C for 16 hours. After washing in cold lysis buffer, the bead-bound proteins were separated by SDS gel electrophoresis and subjected to Western blotting with specific antibodies.
RNA preparation and quantitative RT-PCR
Total RNA was prepared using Direct-zolTM RNA Miniprep Kit from Zymo Research Corp (cat 2053). Total RNA (2 mg) was used to make single-stranded cDNA in 100 mL reaction containing
PT2385: A Hypoxia-Inducible Factor-2a Antagonist
20 mL of 5 buffer (supplied with the Superscript II enzyme), 10 mmol/L of DTT, 200 units of Superscript II (Life Technologies, cat 18064014), 0.5 mmol/L of dNTP mix (Promega, cat U1515), and 40 mg/mL random hexamer primers (Roche, cat 11034731001) using the following thermocycler program: 25 C for 10 minutes,
42 C for 50 minutes, and then 72 C for 10 minutes. A total of 1.25 mL of the resulting cDNA was used in each quantitative PCR reaction in A&B Applied Biosystem ViiA 7 equipment using SYBR Select Master Mix or TaqMan Mix supplied by A&B Applied Biosystem (cat 4472913). Each sample was run in trip-licate. The expression of specific genes was normalized against cyclophillin.
The primer sequences used for quantitative RT-PCR are as follows:
hEpo-F GGAGGCCGAGAATATCACGAC hEpo-R CCCTGCCAGACTTCTACGG hSerpine1 (PAI-1)-F ACCGCAACGTGGTTTTCTCA hSerpine1 (PAI-1)-R TTGAATCCCATAGCTGCTTGAAT hPGK1-F TTAAAGGGAAGCGGGTCGTTA hPGK1-R TCCATTGTCCAAGCAGAATTTGA hPDK1-F GAACCCAAAGACATGACGACG hPDK1-R ATGTCCCAAGTGTGTCTAGGCA hCyclinD1-F TGGAGCCCGTGAAAAAGAGC hCyclinD1-R TCTCCTTCATCTTAGAGGCCAC hGLUT1-F TCTGGCATCAACGCTGTCTTC hGLUT1-R CGATACCGGAGCCAATGGT
hHIF2a-F GCGACAATGACAGCTGACAA hHIF2a-R CAGCATCCCGGGACTTCT hCyclophillin-F TGCCATCGCCAAGGAGTAG hCyclophillin-R TGCACAGACGGTCACTCAAA
Cell proliferation assay
A498 cells (2 103) and 786-O cells (1 104) were seeded in
96-well plates. PT2385 was added to the plates 24 hours after seeding. After 72 hours, thiazolyl blue tetrazolium bromide (MTT, Sigma) was added to the final concentration of 0.5 mg/mL. Four hours later, cell culture media were removed by aspiration, and 100 mL of DMSO was added to each well. After shaking for 10 minutes, optical density was read at 570 nm with a reference filter at 650 nm on a Biotek Synergy.
IHC
Tumor samples were fixed in 10% formalin for 24 hours then stored in 70% alcohol.
Sample processing, embedding, and sectioning were per-formed by HistoTox Labs, Inc.. IHC for Ki67 and active cas-pase-3 was performed by HistoTox Labs, Inc. IHC for CD31 was performed by Reveal Biosciences LLC. IHC for HIF2a was per-formed using mAb (Santa Cruz Biotechnology, sc46691) with 1:500 dilution. The slides were viewed with Nikon Eclipse Ci system, and the images were captured with a Nikon DS-Fi2 imaging system.
Mouse pharmacokinetics of PT2385
PT2385 was suspended in 0.5% methylcellulose, 0.5% Tween 80 in water (w/v) to yield a suspension with concentrations of 3, 10, and 30 mg/mL, respectively. The dosing volume was 10 mL/ kg. Mice were dosed by oral gavage. Blood samples were taken at 0.25, 0.5, 1, 2, 4, 8, 12, and 24 hours postdose from 3 mice per time point. Plasma PT2385 concentration was determined by LC/ MS-MS system (Agilent Technologies).
www.aacrjournals.org Cancer Res; 76(18) September 15, 2016 5493
Wallace et al.
A B
Y278
F446
Y278
H293
M252
H293 M252
Figure 2.
PT2385 induces specific perturbations of HIF2a PAS-B domain residues H293, M252, and Y278. A, superimposition of HIF2a PAS-B apo structure (white) with HIF2a PAS-B co-crystal structure (cyan) containing PT2385 (magenta). B, superimposition of HLH HIF2a (pink)/ARNT (red) with PAS-B co-crystal structure (cyan) containing PT2385 (magenta).
Mouse xenograft models and PT2385 treatment
The protocol and procedures involving the care and use of animals for this study were reviewed and approved by the Insti-tutional Animal Care and Use Committee of University of Texas Southwestern Medical Center (Dallas, TX). A total of 4 106 RCC cells in a volume of 100 ml of PBS and Matrigel (1:1 in volume) were inoculated subcutaneously in the rear right flanks of SCID/ Beige mice of 6 to 7 weeks of age for xenograft development. For the PDX xenograft model, tumor fragments harvested from donor animals at passage 7 were implanted in the flank region of female NCr nude mice (Taconic) of 5 to 8 weeks of age. Tumor size and body weight were measured twice a week.
PT2385 was formulated with 10% absolute ethanol, 30% PEG400, 60% water containing 0.5% methylcellulose and 0.5% Tween 80, and was administered to mice by gavage.
Plasma human and mouse VEGF-A measurements
The plasma levels of human and mouse VEGF-A were measured with the human (catalog #: DVE00) or mouse (catalog #: MMV00) Quantikine VEGF ELISA Kits from The D&D Systems by following the manufacturer’s instructions.
Cardiovascular effect evaluation
The study was performed by CorDynamics, Inc. Briefly, tele-metered male Sprague–Dawley rats were treated with PT2385 at 30 or 100 mg/kg twice daily, or sunitinib at 40 mg/kg once daily for 5 consecutive days. Systemic blood pressure (SAP, DAP, MAP), HR, pulse pressure, and ECG parameters (PR interval, QRS dura-tion) were recorded from predose to 24 hours after the final dose and were reported in hourly averages.
Results
Binding and dimerization disruption
Protein co-crystal structure elucidation using HIF2a/ARNT PAS-B domains demonstrates that PT2385 binds to a fully enclosed lipophilic cavity in the recombinant PAS-B domain of HIF2a (Fig. 1B; refs. 20, 24). The Kd for this PT2385–HIF2a PAS-B interaction is approximately 50 nmol/L as measured by ITC (Fig. 1C). Under the same experimental condition, ITC reveals no binding of PT2385 to the PAS-B domain of HIF1a.
Disruption of the full-length HIF2a/ARNT interaction was assessed by coimmunoprecipitation assay in 786-O cells, a VHL-mutant ccRCC cell line with constitutively active HIF2a and no functional HIF1a due to the truncation of the Hif1a gene.
HIF2a is immunoprecipitated from lysates of 786-O cells treated with PT2385. Immunoblotting shows that ARNT protein copre-cipitating with HIF2a is diminished in response to PT2385 treatment in a dose-dependent manner, indicating that the com-pound disrupts HIF2a/ARNT dimer formation (Fig. 1D).
Structural comparison of PT2385-bound HIF2a/ARNT PAS-B domains and free (apo) PAS-B domains indicates that com-pound binding did not perturb the beta-sheet interface of the two PAS-B domains but did cause significant changes to residues H293, M252, and Y278 on the opposite face of the beta-sheet floor (Fig. 2A).
Examination of the recently reported crystal structure of the more complete helix-loop-helix:PAS-A:PAS-B (HLH-A-B) hetero-dimer of HIF2a and ARNT reveals that the HIF2a/ARNT PAS-B domains occupy a completely different spatial arrangement and dimer interface (25). In this orientation, the perturbed residues now reside at the HIF2a/ARNT PAS-B interface, suggesting that PT2385-induced changes to residues H293, M252, and Y278 are responsible for dimer disruption (Fig. 2B).
Inhibition of HIF2a transcriptional program
PT2385 inhibition of HIF2a transcriptional activity in cells was evaluated by qPCR quantitation of known HIF2a target gene transcripts. Treatment of 786-O cells with PT2385 significantly reduces the levels of mRNA for CCND1, VEGF-A, GLUT1, and PAI-1 in a concentration-dependent manner (Fig. 3A). The spec-ificity of PT2385 was further evaluated in Hep3B hepatoma cells, which accumulate both HIF1a and HIF2a proteins under hypoxia and where HIFa-specific gene regulation has been previously delineated. Treatment of Hep3B cells with PT2385 reduces hyp-oxia-induced expression of erythropoietin (EPO) and PAI-1, both known HIF2a target genes (26–28). Compound treatment has no effect on expression of either PGK1 or pyruvate dehydrogenase kinase 1 (PDK1) genes, which are specifically regulated by HIF1a in Hep3B cells (Fig. 3B; refs. 29, 30). Consistent with the gene expression data, PT2385 only disrupts HIF2a, but not HIF1a, heterodimerization with ARNT in Hep3B cells (Fig. 3C).
PT2385 has no effect on the proliferation or viability of 786-O and A498 cells in culture at concentration as high as 10 mmol/L (Supplementary Fig. S1). This result is consistent with the obser-vations that shRNA- or siRNA-mediated HIF2a knockdown does not affect cell proliferation in vitro (14, 15). Collectively, the in vitro data indicate that PT2385 is a potent and highly selective inhibitor of HIF2a-dependent gene expression.
5494 Cancer Res; 76(18) September 15, 2016 Cancer Research
PT2385: A Hypoxia-Inducible Factor-2a Antagonist
A
VEGF-A
mRNA levels
Relative
PT2385 (μmol/L)
mRNA levels
Relative
mRNA levels
Relative
PT2385 (μmol/L)
mRNA levels
Relative
Pharmacologic activity of PT2385
High plasma levels of PT2385 are achieved by oral dosing in mice, which enables the evaluation of compound effect on gene expression in xenograft tumor models (Supplementary Fig. S2). SCID/beige mice with established 786-O tumors were treated with six doses of PT2385 at 12-hour intervals. Tumors were excised 12 hours after the last dose for RNA analysis. Serum samples were collected for the measurement of human VEGF-A. Expression of HIF2a target genes VEGF-A, CCND1, PAI1, GLUT1, and CXCR4 is inhibited in a dose-dependent manner, whereas the expression of the non-HIF2a target gene PGK1 remains unchanged even at the highest dose (10 mg/kg; Fig. 4A). Consistent with the mRNA data, circulating tumor-derived human VEGF-A and tumor protein cyclin D1 levels are signifi-cantly reduced in response to PT2385 treatment (Fig. 4B and E). Similarly, in the A498 xenograft model, PT2385 treatment (10 mg/kg) inhibited the expression of HIF2a target genes VEGF-A, CCND1, and CXCR4, as well as circulating tumor-derived human
PT2385 (μmol/L) PT2385 (μmol/L)
B
Relative mRNA levels Relative mRNA levels
PT2385 (μmol/L) PT2385 (μmol/L)
Relative mRNA levels Relative mRNA levels
PT2385 (μmol/L) PT2385 (μmol/L)
C
DMSO PT2385
0.01 0.1 1 10 μmol/L
HIF2α
ARNT
HIF1α
IP: ARNT
Figure 3.
PT2385 inhibits HIF2a target gene transcription and is selective for
HIF2a. A, PT2385 treatment inhibits HIF2a target gene expression in 786-O cells. B, PT2385 does not inhibit HIF1a target gene expression in hypoxic Hep3B cells. C, PT2385 does not disrupt HIF1a/ARNT dimer formation in hypoxic Hep3B cells. IP, immunoprecipitation.
VEGF-A levels (Supplementary Fig. S3). Immunohistochemical staining of tumor tissue sections reveals significant reduction of Ki67 and CD31, markers of cell proliferation and of angiogenesis, respectively, in tumors from mice treated with PT2385. Staining of activated caspase-3 shows an increase in positive cells in PT2385-treated tumors, consistent with an increase in tumor cell apoptosis (Fig. 4C).
Unexpectedly, PT2385 also reduced HIF2a mRNA and protein levels in xenograft tumors, an effect that was not observed in 786-O cells in culture (Fig. 4D–F and Supplementary Figs. S3 and S4). This observation raised the possibility that HIF2a might regulate the transcription of its own gene in the xenograft tumors and is consistent with a report that overexpression of HIF2a protein enhances EPAS1 gene promoter activity (31). These find-ings are also consistent with the observation that HIF2a mRNA levels were elevated in ccRCC tumors with VHL mutations (32).
Antitumor activity in ccRCC models
Tumor xenografts were established in the flanks of SCID/beige mice with the 786-O and A498 RCC cell lines. When tumor size reached 200 to 300 mm3, the mice were administered PT2385 by oral gavage at indicated doses on a daily basis. In the 786-O xenograft model, both 3 and 10 mg/kg PT2385 given twice daily result in a rapid, dose-dependent tumor regression. In contrast, a multi-tyrosine kinase inhibitor, sunitnib, at 40 mg/kg given once daily produces only tumor stasis (Fig. 5A and B). In the A498 xenograft model, PT2385 induces tumor stasis at 6 mg/kg once daily and tumor regression at 20 and 60 mg/kg once daily. Sunitinib at 40 mg/kg once daily has a similar effect as the higher doses of PT2385 (Fig. 5C and D).
We further evaluated the antitumor efficacy of PT2385 in a patient-derived xenograft (PDX) model. The ccRCC tumor is VHL deficient, expresses both HIF1a and HIF2a (Supplemen-tary Fig. S5), and is derived from a patient that progressed after treatment with sunitinib and everolimus. Tumor-bearing mice were treated with 30 mg/kg of PT2385 twice daily or 40 mg/kg of sunitinib once daily. After 4 weeks, PT2385 treatment completely inhibited tumor growth, whereas sunitinib had no impact (Fig. 5E). These data indicate that PT2385 has efficacy in VHL-mutant ccRCC tumors that express both HIF1a and HIF2a proteins. Furthermore, PT2385 demonstrated superior efficacy to sunitinib in 2 of 3 models evaluated, supporting that HIF2a antagonism has broad antitumor effects beyond
www.aacrjournals.org Cancer Res; 76(18) September 15, 2016 5495
Wallace et al.
A
*
**
**
*
**
**
**
**
* **
**
**
**
Figure 4.
Pharmacologic activity of PT2385.
B C
*
**
* **
Caspase-3
D Ki67 CD-31
Vehicle
PT2385
E F Vehicle PT2385 10 mg/kg
Vehicle PT2385 10 mg/kg
HIF2α
Cyclin D1
Actin
786-O tumor-bearing mice received six oral doses of PT2385 on twice daily schedule. Twelve hours after the last dose, tumors were excised. A, the levels of mRNA for HIF2a-regulated genes VEGF-A, CCND1, GLUT1, PAI1, and CXCR4 were decreased. The mRNA levels of non-HIF2a target gene PGK did not change. B, circulating human VEGF-A levels were reduced.
, P < 0.05; , P < 0.01 (unpaired t test comparing treated group with vehicle control group). C, qRT-PCR indicates reduction of HIF2a mRNA in response to PT2385 treatment. D, IHC indicates decreased Ki67 AND CD31 and increased active caspase-3 in tumors. Each image is from an individual tumor. E, immunoblotting shows reduction of HIF2a and cyclin D1 proteins in tumors treated with PT2385 (five tumors from each of the control and treated groups). F, IHC indicates that PT2385 treatment reduces HIF2a protein in tumors. Each image was from an individual tumor. antiangiogenesis in ccRCC. PT2385 was well tolerated in all three models, with no weight loss or behavioral changes observed (Supplementary Fig. S6A–S6C). Cardiovascular assessment of PT2385 Hypertension is a common side effect of antibodies and tyrosine kinase inhibitors that target VEGF/VEGFR2 signaling 5496 Cancer Res; 76(18) September 15, 2016 Cancer Research A B ** ** ** PT2385: A Hypoxia-Inducible Factor-2a Antagonist ** ** ** C D ** ** E * ** ** ** Figure 5. Antitumor activity of PT2385 in ccRCC models. Daily PT2385 or sunitinib treatment was initiated when the flank xenograft tumor reached 200 to 300 mm3 for A–E. A, PT2385 inhibits tumor growth in 786-O xenograft model (n ¼ 8). q.d., once daily; b.i.d., twice daily. B, PT2385 reduces tumor weight in 786-O xenograft model (n ¼ 8). C, PT2385 inhibits tumor growth in A498 xenograft model (n ¼ 8). D, PT2385 reduces tumor weight in A498 xenograft model (n ¼ 8). E, PT2385 inhibits tumor growth in a patient-derived ccRCC xenograft model (n ¼ 8). , P < 0.05; , P < 0.01 (unpaired t test comparing treated group with vehicle control group). (33–35). As PT2385 inhibits VEGF-A production in tumor cells, it is of interest to examine whether it elicits hemodynamic effects in a rodent model (36). Na€ve telemetered male Sprague–Dawley rats were treated with PT2385 or sunitinib for 5 days. Systemic blood pressure, heart rate, pulse pressure, and ECG parameters were recorded and reported hourly for the entire duration of the dosing regiment. At either dose tested, PT2385 does not have any detectable effect on any hemodynamic or electrocardiographic www.aacrjournals.org Cancer Res; 76(18) September 15, 2016 5497 Wallace et al. A We further examined whether PT2385 altered host VEGF-A production in tumor-bearing mice. SCID/beige mice bearing A498 xenograft tumors were treated with PT2385 for 24 days. Serum mouse and human VEGF-A levels were determined 12 hours after the final dose (trough drug concentrations). PT2385 does not reduce circulating mouse VEGF-A but reduces tumor-derived human VEGF-A levels (Fig. 6B and C). The lack of effect on mouse VEGF-A is not due to species selectivity of PT2385 in antagonizing HIF2a. The compound inhibits rodent HIF2a as it binds to rat HIF2a and reduces mouse EPO mRNA levels in the kidney (Supplementary Fig. S7A and S7B). A likely explanation for the lack of effect on host VEGF-A production is that unlike VEGF-A expression in the RCC tumors, host VEGF-A expression is regulated by other factors than HIF2a. B C Figure 6. Impact of PT2385 on blood pressure and host VEGF-A expression. A, telemetered rats were treated with PT2385 or sunitinib for 5 consecutive days. q.d., once daily; b.i.d., twice daily. Mean arterial pressure was reported in hourly averages. Sunitinib caused a progressive increase of blood pressure, whereas PT2385 exerted no effect. B, PT2385 does not change the levels of circulating mouse VEGF-A in A498 xenograft tumor–bearing mice after 24 days of treatment, whereas it significantly reduced tumor-derived human VEGF-A. , P < 0.05 (unpaired t test comparing treated group with vehicle control group). parameters. In contrast, administration of sunitinib results in a progressive increase in systemic arterial blood pressure (Fig. 6A). There were no notable changes in pulse pressure or ECG para-meters observed in rats treated with either compound. Discussion The oncogenic role of HIFa proteins in ccRCC is strongly implicated by human genetics. First, patients carrying germline mutations in the VHL gene are predisposed to ccRCC (37). Second, inactivation of pVHL due to somatic mutations and/or epigenetic modifications has been found in a majority of sporadic ccRCC tumors (8). pVHL deficiency leads to the stabilization of HIFa proteins, which enhance the expression of genes normally activated only when cells are under hypoxic stress. HIFa-activated gene products support cell survival and proliferation and, thus, can promote tumorigenesis. Although both HIF1a and HIF2a are stabilized as a result of pVHL deficiency, there is a preponderance of evidence in support of HIF2a being the oncogenic driver for ccRCC (vide supra). For these reasons, HIF2a has long been viewed as a potential target in the search for breakthrough treatments for ccRCC. Using structure-based design employing the PAS-B domains of HIF2a and ARNT, we have discovered potent, selective, orally bioavailable HIF2a antagonist PT2385. This discovery is note-worthy as PT2385 is a direct antagonist of a gene-specific tran-scription factor not of the nuclear hormone receptor family, thereby establishing binding to PAS-B domains as a viable mode for the discovery of novel transcription factor antagonists. Eval-uation of available protein:inhibitor crystallographic data allows us to propose a mechanism for small-molecule inhibition of HIF2a transcriptional activity with PT2385. The x-ray co-crystal structure of PT2385 with the PAS-B domains of the HIF2a/ARNT complex (Fig. 1B) shows that PT2385 is completely engulfed within HIF2a. Although this structure reveals important points of interaction within the complex that enabled lead optimization and ultimately to the discovery of PT2385, it does not explain how PT2385 is able to allosterically disrupt the HIF2a/ARNT dimer. In the PT2385-bound HIF2a structure, the beta-sheet interface of the two PAS-B domains show essentially no perturbations compared with the unbound (apo) structure. However, there are significant perturbations of HIF2a residues H293, M252, and Y278 on the opposite face of the beta-sheet floor (Fig. 2A). The significance of these perturbations became apparent in light of a recently pub-lished crystal structure of the more complete HLH-A-B hetero-dimer of HIF2a and ARNT, which revealed an alternative spatial arrangement and interface of the two PAS-B domains (25). Although the folds for both HIF2a PAS-B domain structures are essentially identical, the domain arrangement of the HLH-A-B dimer revealed that the PT2385 perturbed amino acids are now located at the HIF2a/ARNT PAS-B interface (Fig. 2B), suggesting 5498 Cancer Res; 76(18) September 15, 2016 Cancer Research that they may be responsible for dimer disruption. In support of this argument, a mutation in ARNT (F466L) rendered a PDX tumor line resistant to dimer disruption by a structurally related HIF2a inhibitor (J. Brugarolas, personal communication). In the apo structure, ARNT residue F466 is in very close proximity to HIF2a Y278 (Fig. 2A). The binding of PT2385 creates a highly unfavorable van der Waals interaction between ARNT F466 and HIF2a Y278 caused by the concerted movement of HIF2a PAS-B residues H293 and M252. ARNT F466L mutation would alleviate the steric clash, allowing the dimer to remain intact. This mech-anistic hypothesis suggests perturbation of a few amino acid residues within the PAS-B domain is sufficient to disrupt a large protein:protein interface leading to complete blockage of HIF2a-driven gene transcription. Using PT2385, we are able to evaluate the role of HIF2a in ccRCC. HIFa proteins control a large battery of genes in a cell type- and cell context-dependent manner (8). In the current study, we observe strong inhibition of VEGF-A, PAI-1, cyclin D1, CXCR4, and GLUT1 gene expression with PT2385 treatment and no effect on HIF1a-controlled genes (Figs. 3A and B and 4A). Each of the genes regulated by PT2385 plays a unique role contributing to tumor growth or metastasis. Consistent with inhibition of multiple gene products involved in tumor-igenesis, PT2385 exhibits strong antitumor activity, including a PDX model that expresses both HIF2a and HIF1a (Fig. 5E). In cell line xenografts that express high levels of HIF2a, PT2385 treatment results in rapid regression of established tumors (Fig. 5A–D). IHC of tumor sections indicates that PT2385 treatment reduced angiogenesis, cell proliferation, and increased cell apoptosis (Fig. 4C), indicating that multiple mechanisms con-tribute to its antitumor activity. PT2385 shows no effect on the proliferation of ccRCC tumor cell lines in culture, even though it inhibits HIF2a target gene transcription (Fig. 3A and Supplementary Fig. S1). The lack of cytotoxicity of HIF2a antagonism in vitro is consistent with previous studies showing shRNA-mediated HIF2a knockdown does not affect cell survival and proliferation in culture but does inhibit xenograft tumor growth (14, 15). These results reinforce the conclusion that PT2385 inhibits tumor growth through selec-tive inhibition of HIF2a signaling, and not because of general cytotoxicity. The discrepancy between in vitro and in vivo tumor cell response to PT2385 may be attributed to the ability of in vitro growth medium to allow the cells to become independent of HIF2a signaling. Another discrepancy between in vitro and in vivo effects of HIF2a antagonism involves HIF2a levels. In excised 786-O tumors after PT2385 treatment, both tumor HIF2a mRNA and protein are decreased in a dose-dependent manner (Fig. 4D and E). Neither is diminished in cell culture (Supplementary Fig. S4). Previous research suggests that HIF2a regulates its transcription (31, 32), supporting that the reduction of HIF2a observed in vivo after PT2385 treatment is the result of inhibition of transcription. However, at this time, we cannot rule out that HIF2a/ARNT heterodimerization disruption with PT2385 treatment results in increased HIF2a protein instability. Regardless of the precise mechanism, the effect of PT2385 on HIF2a target gene inhibition appears to be the result of both inhibition of HIF2a transcriptional activity and reduction of HIF2a protein levels. As appears to also be the case in cell proliferation experiments, in vitro cell culture PT2385: A Hypoxia-Inducible Factor-2a Antagonist conditions may diminish the putative role of HIF2a. Not surprisingly, these data suggest that in vitro conditions appear unsuitable to study the tumor microenvironment effects of hypoxia signaling. The HIF2a protein does not accumulate in the majority of normal adult tissues due to its restricted expression pattern and tight posttranslational control. The limited role of HIF2a in normal adult physiology suggests that as therapeutics, specific HIF2a antagonists may have few side effects. In rodents, under all conditions tested herein, PT2385 is well tolerated, with no weight loss or behavioral changes observed. Importantly, treatment of xenograft tumor–bearing mice with PT2385 represses circulating tumor-derived human VEGF-A levels but has no effect on levels of host VEGF-A (Fig. 6B and C). In addition to its control of multiple tumorigenic gene products, specific inhibition of tumor-derived VEGF-A inhibition distinguishes HIF2a antagonists from the currently approved antiangiogenic therapies whose systemic angiogenesis inhibition leads to cardiovascular safety concerns. In particular, hypertension is one of the most frequently observed adverse effects in patients treated with anti-VEGF therapy and can often be dose limiting (34, 38). Under conditions in which sunitinib causes a large increase in blood pressure in rats, no change is observed with PT2385 treatment (Fig. 6A). The lack of hypertension coupled with tumor regression without any adverse events in preclinical models suggests that HIF2a antagonism with PT2385 may provide patients afflicted with ccRCC, a novel therapeutic option with an exceptional safety profile. As such, clinical evaluation of PT2385 for the treatment of kidney cancer is ongoing.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Authors’ Contributions
Conception and design: E.M. Wallace, J.P. Rizzi, G. Han, P.M. Wehn, Z. Cao,
J.A. Grina, S.T. Schlachter, H. Tan, B. Wang, R. Xu, J.A. Josey
Development of methodology: Z. Cao, X. Du, T. Cheng, H. Tan, B. Wang, S. Xie,
R. Xu, H. Yang
Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): G. Han, Z. Cao, X. Du, T. Cheng, R.M. Czerwinski, B.S. Goggin, M.M. Halfmann, M.A. Maddie, H. Tan, K. Wang, S. Xie, R. Xu Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): E.M. Wallace, J.P. Rizzi, G. Han, Z. Cao, X. Du, T. Cheng, D.D. Dixon, B.S. Goggin, M.M. Halfmann, S.R. Olive, H. Tan, K. Wang, S. Xie, R. Xu
Writing, review, and/or revision of the manuscript: E.M. Wallace, J.P. Rizzi, G. Han, Z. Cao, X. Du, D.D. Dixon, R. Xu, J.A. Josey
Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): J.P. Rizzi, D.D. Dixon, B.S. Goggin, M.M. Halfmann, S.R. Olive
Study supervision: E.M. Wallace, G. Han, Z. Cao, J.A. Josey
Grant Support
This work was supported in part by Cancer Prevention and Research Institute of Texas (all authors).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received February 22, 2016; revised June 19, 2016; accepted July 6, 2016; published OnlineFirst September 6, 2016.
www.aacrjournals.org Cancer Res; 76(18) September 15, 2016 5499
Wallace et al.
References
1. American Cancer Society. Kidney cancer (adult) – renal cell carcinoma. Atlanta, GA: American Cancer Society; 2014.
2. Sosman J, Puzanov I. Combination targeted therapy in advanced renal cell carcinoma. Cancer 2009;115:2368–75.
3. Wang GL, Jiang BH, Rue EA, Semenza GL. Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc Natl Acad Sci USA 1995;92:5510–14.
4. Tian H, McKnight SL, Russell DW. Endothelial PAS domain protein 1 (EPAS1), a transcription factor selectively expressed in endothelial cells. Genes Dev 1997;11:72–82.
5. Gu YZ, Moran SM, Hogenesch JB, Wartman L, Bradfield CA. Molec-ular characterization and chromosomal localization of a third alpha-class hypoxia inducible factor subunit, HIF3alpha. Gene Expr 1998; 7:205–13.
6. Kaelin WGJr, Ratcliffe PJ. Oxygen sensing by metazoans: the central role of the HIF hydroxylase pathway. Mol Cell 2008;30:393–402.
7. Majmundar AJ, Wong WJ, Simon MC. Hypoxia-inducible factors and the response to hypoxic stress. Mol Cell 2010;40:294–309.
8. Keith B, Johnson RS, Simon MC. HIF1a and HIF2a: sibling rivalry in hypoxic tumour growth and progression. Nat Rev Cancer 2011;12:9–22.
9. Jaakkola P, Mole DR, Tian YM, Wilson MI, Gielbert J, Gaskell SJ, et al. Targeting of HIF-alpha to the von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science 2001;292:468–472.
10. Bruick RK, McKnight SL. A conserved family of prolyl-4-hydroxylases that modify HIF. Science 2001;294:1337–40.
11. Sato Y, Yoshizato T, Shiraishi Y, Maekawa S, Okuno Y, Kamura T, et al. Integrated molecular analysis of clear-cell renal cell carcinoma. Nat Genet 2013;45:860–7.
12. Kondo K., Klco J, Nakamura E, Lechpammer M, Kaelin WGJr. Inhibition of HIF is necessary for tumor suppression by the von Hippel-Lindau protein. Cancer Cell 2002;1:237–46.
13. Maranchie JK, Vasselli JR, Riss J, Bonifacino JS, Linehan WM, Klausner RD. The contribution of VHL substrate binding and HIF1-alpha to the phenotype of VHL loss in renal cell carcinoma. Cancer Cell 2002; 1:247–55.
14. Kondo K, Kim WY, Lechpammer M, Kaelin WGJr.Inhibition of HIF2alpha is sufficient to suppress pVHL-defective tumor growth. PLoS Biol 2003; 1:E83.
15. Zimmer M, Doucette D, Siddiqui N, Iliopoulos O. Inhibition of hypoxia-inducible factor is sufficient for growth suppression of VHL-/- tumors. Mol Cancer Res 2004;2:89–95.
16. Monzon FA, Alvarez K, Peterson L, Truong L, Amato RJ, Hernandez-McClain J, et al. Chromosome 14q loss defines a molecular subtype of clear-cell renal cell carcinoma associated with poor prognosis. Mod Pathol 2011;24:1470–9.
17. Shen C, Beroukhim R, Schumacher SE, Zhou J, Chang M, Signoretti S, et al. Genetic and functional studies implicate HIF1a as a 14q kidney cancer suppressor gene. Cancer Discov 2011;1:222–35.
18. Rogers JL, Bayeh L, Scheuermann TH, Longgood J, Key J, Naidoo J, et al. Development of inhibitors of the PAS-B domain of the HIF-2a transcrip-tion factor. J Med Chem 2013;56:1739–47.
19. Scheuermann TH, Li Q, Ma HW, Key J, Zhang L, Chen R, et al. Allosteric inhibition of hypoxia inducible factor-2 with small molecules. Nat Chem Biol 2013;9:271–6.
20. Scheuermann TH, Tomchick DR, Machius M, Guo Y, Bruick RK, Gardner KH. Artificial ligand binding within the HIF2a PAS-B domain of the HIF2 transcription factor. Proc Natl Acad Sci USA 2009;106:450–5.
21. Otwinowski Z, Minor W. Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol 1997;276:307–26.
22. Emsley P, Cowtan K. Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr 2004;60:2126–32.
23. Murshudov GN, Vagin AA, Dodson EJ. Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr D Biol Crystallogr 1997;53:240–55.
24. Key J, Scheuermann TH, Anderson PC, Daggett V, Gardner KH. Principles of ligand binding within a completely buried cavity in HIF2a PAS-B. J Am Chem Soc 2009;132:17647–54.
25. Wu D, Potluri N, Lu J, Kim Y, Rastinejad F. Structural integration in hypoxia-inducible factors. Nature 2015;524:303–8.
26. Gruber M, Hu CJ, Johnson RS, Brown EJ, Keith B, Simon MC. Acute postnatal ablation of Hif-2alpha results in anemia. Proc Natl Acad Sci USA 2007;104:2301–6.
27. Rankin EB, Biju MP, Liu Q, Unger TL, Rha J, Johnson RS, et al. Hypoxia-inducible factor-2 (HIF-2) regulates hepatic erythropoietin in vivo. J Clin Invest 2007;117:1068–77.
28. Nakamura E, Abreu-e-Lima P, Awakura Y, Inoue T, Kamoto T, Ogawa O, et al. Clusterin is a secreted marker for a hypoxia-inducible factor-inde-pendent function of the von hippel-lindau tumor suppressor protein. Am J Pathol 2006;168:574–84.
29. Hu C-J, Wang L-Y, Chodosh LA, Keith B, Simon MC. Differential roles of hypoxia-inducible factor 1a (hif-1a) and hif-2a in hypoxic gene regulation. Mol Cell Biol 2003;23:9361–74.
30. Kim WY, Safran M, Buckley MR, Ebert BL, Glickman J, Bosenberg M, et al. Failure to prolyl hydroxylate hypoxia-inducible factor a phenocopies VHL inactivation in vivo. EMBO J 2006;25:4650–62.
31. Sato M, Tanaka T, Maeno T, Sando Y, Suga T, Maeno Y, et al. Inducible expression of endothelial pas domain protein-1 by hypoxia in human lung adenocarcinoma A549 cells role of src family kinases-dependent pathway. Am J Respir Cell Mol Biol 2002;26:127–34.
32. Gordan JD, Lal P, Dondeti VR, Letrero R, Parekh KN, Oquendo CE, et al. HIF-a effects on c-Myc distinguish two subtypes of sporadic VHL-deficient clear cell renal carcinoma. Cancer Cell 2008;14:435–46.
33. Kamba T, McDonald DM. Mechanisms of adverse effects of anti-VEGF therapy for cancer. Br J Cancer 2007;96:1788–1795.
34. Hamnvik OP, Choueiri TK, Turchin A, McKay RR, Goyal L, Davis M, et al. Clinical risk factors for the development of hypertension in patients treated with inhibitors of the VEGF signaling pathway. Cancer 2015;121:311–9.
35. Facemire CS, Nixon AB, Griffiths R, Hurwitz H, Coffman TM. Vascular endothelial growth factor receptor 2 (vegfr2) controls blood pressure by regulating nitric oxide synthase expression. Hypertension 2009;54:652–8.
36. Kappers MHW, van Esch JHM, Sluiter W, Sleijfer S, Danser AHJ, van den Meiracker AH. Hypertension induced by the tyrosine kinase inhibitor sunitinib is associated with increased circulating endothelin-1 levels. Hypertension 2010;56:675–81.
37. Shen C, Kaelin WG. The VHL/HIF axis in clear cell renal carcinoma. Sem Cancer Biol 2013;23:18–25.
38. Jain RK, Duda DG, Clark JW, Loeffler JS. Lessons from phase III clinical trials on anti-VEGF therapy for cancer. Nat Clin Pract Oncol 2006;3:24–40.